View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10666_low_29 (Length: 240)
Name: NF10666_low_29
Description: NF10666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10666_low_29 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 139 - 240
Target Start/End: Complemental strand, 28927635 - 28927537
Alignment:
| Q |
139 |
ttctctactatttgttgctgaaatgatgaaagatctttttcctttttgtttcccgaaatttcatcaaaggtagtatatggtgtgcattaaactgatcctc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
28927635 |
ttctctactatttgttgctgaaatgatgaaagatctttttcctttttgtttcccgaaattttgtcaaag---gtatatggtgtgcattaaactgatcctc |
28927539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 72
Target Start/End: Complemental strand, 28927758 - 28927701
Alignment:
| Q |
15 |
aatatcaaatggttgacaatcacttcaagaactcttgaggtaccttagagcctgctat |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28927758 |
aatatcaaatggttgacaatcacttcaagaactcttgaggtaccttagagcctgctat |
28927701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University