View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10666_low_31 (Length: 239)
Name: NF10666_low_31
Description: NF10666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10666_low_31 |
 |  |
|
| [»] scaffold0186 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0186 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: scaffold0186
Description:
Target: scaffold0186; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 6275 - 6052
Alignment:
| Q |
1 |
tccatgaaatatgatatcattagatcattttttaaagttcaacaaatctaaaaattcatctttttgaaagaaatcattataaaattgattctatgtttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6275 |
tccatgaaatatgatatcattagatcattttctaaagttcaacaaatctataaattcatctttttgaaagaaatcattataaaattggttctatgtttta |
6176 |
T |
 |
| Q |
101 |
agacacttgaatggttctaagtttgaataggtgtggtggtgcctactatcattatcatgactacacgaagaaaatgattattaagtatttttaggcaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||| |
|
|
| T |
6175 |
agacacttgaatggttctaagtttgaataggtgtggtggtgcctactatcattatcatgaatataggaagaaaatgattattaagtatttttaggcaagt |
6076 |
T |
 |
| Q |
201 |
acgaataattattaagttgatagg |
224 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
6075 |
acgaataattattaagctgatagg |
6052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 117 - 192
Target Start/End: Complemental strand, 134742 - 134667
Alignment:
| Q |
117 |
ctaagtttgaataggtgtggtggtgcctactatcattatcatgactacacgaagaaaatgattattaagtattttt |
192 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||| || | | ||||||| || ||||||| ||||| |
|
|
| T |
134742 |
ctaagtttgaataggtgtcgtggtgactactatcattatcatgattatagggagaaaataatgattaagttttttt |
134667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University