View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10666_low_33 (Length: 235)
Name: NF10666_low_33
Description: NF10666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10666_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 6 - 218
Target Start/End: Complemental strand, 13053750 - 13053538
Alignment:
| Q |
6 |
gagtagcataggattctaaagacatttctacagtttcttcagcagcatcagataatctaggctgattctctgcaatattattgaccttagcatccatatt |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13053750 |
gagtagcattggattctaaagacatttctacagtttcttcagcagcatcagataatctaggctgattctctgcaatattattgaccttagcatccatatt |
13053651 |
T |
 |
| Q |
106 |
ctcagtttccaccnnnnnnnnctctttattaatagtcgctattgagattgcttctacagacaaaactggggtcctctgataattcttatcccctgaataa |
205 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13053650 |
ctcagtttccaccttttttttctctttattaatagtcgctattgagattgcttctacagacaaaactggggtcctctgataattcttatcccctgaataa |
13053551 |
T |
 |
| Q |
206 |
tcctcatagttag |
218 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13053550 |
tcctcatagttag |
13053538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University