View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10666_low_35 (Length: 229)
Name: NF10666_low_35
Description: NF10666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10666_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 67 - 207
Target Start/End: Complemental strand, 54951344 - 54951202
Alignment:
| Q |
67 |
atgagatgaataagaaacggacgaagggcatataaaagtgaga-aaaatatcataatacaaaatcccaacagtt-aatcgatgattcttgtggttagata |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54951344 |
atgagatgaataagaaacggacgaagggcatataaaagtgagataaaatatcataatacaaaatcccaacagttgaatcgatgattcttgtggttagata |
54951245 |
T |
 |
| Q |
165 |
gattaataatttattgaactaacttatataagcttatttgatc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
54951244 |
gattaataatttattgaactaacttatataagcttgtttgatc |
54951202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University