View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10667_low_13 (Length: 250)

Name: NF10667_low_13
Description: NF10667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10667_low_13
NF10667_low_13
[»] chr5 (1 HSPs)
chr5 (1-145)||(26610710-26610854)


Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 26610854 - 26610710
Alignment:
1 aacacagggcagttacagttaggtttgaaattaaggatatactttaatatttttataggaatctaccgtagttattatgtctttagctccctagtagatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26610854 aacacagggcagttacagttaggtttgaaattaaggatatactttaatatttttataggaatctaccgtagttattatgtctttagctccctagtagatc 26610755  T
101 aatggaatatctcttcaagcttaaaacatttttattgacaaataa 145  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
26610754 aatggaatatctcttcaagcttaaaacatttttattgacaaataa 26610710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University