View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10667_low_14 (Length: 249)
Name: NF10667_low_14
Description: NF10667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10667_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 8087835 - 8088044
Alignment:
| Q |
19 |
ataaggccattccgaggtatttatttatggagctttattaggcaactattaagcaatcaccacaattgtatccattgttaatgacctaaataaaatgatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
8087835 |
ataaggccattccgaggtatttatttatggagctttattaggcaactatcaagaaatcaccacaattgtattcattgttaatgacctaaataaaatgttc |
8087934 |
T |
|
| Q |
119 |
tacttgttcacnnnnnnnnnntgttctaggtacaaaatggaggtgcaaactttgcataagtttgataatgctaggtttccagtatgtgatataaattatg |
218 |
Q |
| |
|
|||||||||| || ||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8087935 |
tacttgttcaaaaa------------ta-atacaagatggaggtgcaagctttgcataagtttgataatgctaggtttccagtatgtgatataaattatg |
8088021 |
T |
|
| Q |
219 |
cttcaatcttgggcatctctgct |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8088022 |
cttcaatcttgggcatctctgct |
8088044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University