View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10667_low_16 (Length: 241)
Name: NF10667_low_16
Description: NF10667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10667_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 9)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 10047141 - 10046985
Alignment:
| Q |
1 |
ttcttcaccacctcttccttaattacagcctcacacaccactgatttccctctcccttcaatccaattcaccgccgcggctttcttatccgaacaaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10047141 |
ttcttcaccacctcttccttaattacagcctcacacaccactgatttccctctcccttcaatccaattcaccgccgcggctttcttatccgaacaaaaat |
10047042 |
T |
|
| Q |
101 |
ttcctattattaccaaaacacgttacatcacaatttgaccaataactttgaacatac |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10047041 |
ttcctattattaccaaaacacgttacatcacaatttgaccaacaactttgaacatac |
10046985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 10867393 - 10867290
Alignment:
| Q |
1 |
ttcttcaccacctcttccttaattacagcctcacacaccactgatttccctctcccttcaatccaattcaccgccgcggctttcttatccgaacaaaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
10867393 |
ttcttcaccacctcttccttaattacagcctcacacaccactgatttccctctcccttcaatccaattcactgccgcagctttcttgtccgaacaaaaat |
10867294 |
T |
|
| Q |
101 |
ttcc |
104 |
Q |
| |
|
|||| |
|
|
| T |
10867293 |
ttcc |
10867290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 10886976 - 10887079
Alignment:
| Q |
1 |
ttcttcaccacctcttccttaattacagcctcacacaccactgatttccctctcccttcaatccaattcaccgccgcggctttcttatccgaacaaaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
10886976 |
ttcttcaccacctcttccttaattacagcctcacacaccactgatttccctctcccttcaatccaattcactgccgcagctttcttgtccgaacaaaaat |
10887075 |
T |
|
| Q |
101 |
ttcc |
104 |
Q |
| |
|
|||| |
|
|
| T |
10887076 |
ttcc |
10887079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 39676936 - 39676833
Alignment:
| Q |
1 |
ttcttcaccacctcttccttaattacagcctcacacaccactgatttccctctcccttcaatccaattcaccgccgcggctttcttatccgaacaaaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
39676936 |
ttcttcaccacctcttccttaattacagcctcacaaaccactgatttccctctcccttcaatccaattcaccgccgcagctttcttgtccgaacaaaaat |
39676837 |
T |
|
| Q |
101 |
ttcc |
104 |
Q |
| |
|
|||| |
|
|
| T |
39676836 |
ttcc |
39676833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 10872919 - 10873022
Alignment:
| Q |
1 |
ttcttcaccacctcttccttaattacagcctcacacaccactgatttccctctcccttcaatccaattcaccgccgcggctttcttatccgaacaaaaat |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
10872919 |
ttcttcaccacatcttccttaattacagcctcacacaccactgatttccctctcccttcaatccagttcactgccgcagctttcttgtccgaacaaaaat |
10873018 |
T |
|
| Q |
101 |
ttcc |
104 |
Q |
| |
|
|||| |
|
|
| T |
10873019 |
ttcc |
10873022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 10877990 - 10878093
Alignment:
| Q |
1 |
ttcttcaccacctcttccttaattacagcctcacacaccactgatttccctctcccttcaatccaattcaccgccgcggctttcttatccgaacaaaaat |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
10877990 |
ttcttcaccacatcttccttaattacagcctcacacaccactgatttccctctcccttcaatccagttcactgccgcagctttcttgtccgaacaaaaat |
10878089 |
T |
|
| Q |
101 |
ttcc |
104 |
Q |
| |
|
|||| |
|
|
| T |
10878090 |
ttcc |
10878093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 10883061 - 10883164
Alignment:
| Q |
1 |
ttcttcaccacctcttccttaattacagcctcacacaccactgatttccctctcccttcaatccaattcaccgccgcggctttcttatccgaacaaaaat |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
10883061 |
ttcttcaccacatcttccttaattacagcctcacacaccactgatttccctctcccttcaatccagttcactgccgcagctttcttgtccgaacaaaaat |
10883160 |
T |
|
| Q |
101 |
ttcc |
104 |
Q |
| |
|
|||| |
|
|
| T |
10883161 |
ttcc |
10883164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 37950194 - 37950089
Alignment:
| Q |
1 |
ttcttcaccacctcttccttaattacagcctcacacaccactgatttccctctcccttcaatccaattcaccgccgcggctttcttatccgaacaaaaat |
100 |
Q |
| |
|
||||||||||| ||||| || || | || ||||| || ||||||||||| | || ||||||||||| || || || | |||||||||||||||| ||| |
|
|
| T |
37950194 |
ttcttcaccacatcttctttgataattgcttcacaaacaactgatttcccgcgtccctcaatccaattaactgcggcaggtttcttatccgaacaataat |
37950095 |
T |
|
| Q |
101 |
ttccta |
106 |
Q |
| |
|
|||||| |
|
|
| T |
37950094 |
ttccta |
37950089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 224
Target Start/End: Complemental strand, 10046946 - 10046918
Alignment:
| Q |
196 |
gttattcatacctgatataccaataacat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10046946 |
gttattcatacctgatataccaataacat |
10046918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 30708209 - 30708313
Alignment:
| Q |
1 |
ttcttcaccacctcttccttaattacagcctcacacaccactgatttccctctcccttcaatccaattcaccgccgcggctttcttatccgaacaaaaat |
100 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||| || || || | |||||||||||| || || ||||| |||||||| || ||||| |||| |
|
|
| T |
30708209 |
ttcttcacaacctcttccttaataacagcctcacacaccacagacttaccacgcccttcaatccagtttacagccgccgctttcttgtcggaacagaaat |
30708308 |
T |
|
| Q |
101 |
ttcct |
105 |
Q |
| |
|
||||| |
|
|
| T |
30708309 |
ttcct |
30708313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University