View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10667_low_26 (Length: 211)
Name: NF10667_low_26
Description: NF10667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10667_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 3e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 19 - 147
Target Start/End: Complemental strand, 26611458 - 26611331
Alignment:
| Q |
19 |
attcattaaatttaagtgctttattcgatgtgacaatgtacaacccaannnnnnnnnnnnnnnnnnnnncatgcattggagatgcctaaaactttctctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||||| |
|
|
| T |
26611458 |
attcattaaatttaagtgctttattcgatgtgacaatgtacaacccaattttttaatgtttttaattttcattcattg-agatgcctaaaactttctctt |
26611360 |
T |
|
| Q |
119 |
tttaccatcaacaaaacaaaaaggataac |
147 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26611359 |
tttaccatcaacaaaacaaaaaggataac |
26611331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 160 - 198
Target Start/End: Complemental strand, 26611311 - 26611273
Alignment:
| Q |
160 |
tgttttctcaacaacaaaagatatattatggaccctatg |
198 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26611311 |
tgttttctcaacaacagaagatatattatggaccctatg |
26611273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University