View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10667_low_4 (Length: 349)
Name: NF10667_low_4
Description: NF10667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10667_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 186 - 332
Target Start/End: Complemental strand, 44405454 - 44405308
Alignment:
| Q |
186 |
ctaaagcttaattttagttgcgaaattaatactatagtatattattcaatcctaaagttgaagaaacaagtaatgcctccccctgataatcaattttttt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44405454 |
ctaaagcttaattttagttgcgaaattaatactatagtatattattcaatcctaaagttgaagaaacaagtaatgcctccccctgataatcaattttttt |
44405355 |
T |
|
| Q |
286 |
cctaatannnnnnnnaagaaacaagcattattaatttaattggatcc |
332 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44405354 |
cctaatattttttttaagaaacaagcattattaatttaattggatcc |
44405308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 44405639 - 44405517
Alignment:
| Q |
1 |
tgtgggaaacaagatggtgagtggtttgatggttgtttaaattcatatacaatacatttttattttaggggaatatccaatataatttatgatggttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44405639 |
tgtgggaaacaagatggtgagtggtttgatggttgtttaaattcatatacaatacatttttattttaggggaatatccaatataatttatgatggttgtt |
44405540 |
T |
|
| Q |
101 |
taaaaatctttacaccgaaaatg |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44405539 |
taaaaatctttacaccgaaaatg |
44405517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University