View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10667_low_8 (Length: 291)

Name: NF10667_low_8
Description: NF10667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10667_low_8
NF10667_low_8
[»] chr1 (1 HSPs)
chr1 (19-179)||(32365486-32365647)


Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 179
Target Start/End: Original strand, 32365486 - 32365647
Alignment:
19 agtaagcttctgcgttttggttggtgattcaaggttcgaagccaagttagtgggtttggggtttt-ttcgcccggtggctcttctttctcttttcagatt 117  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
32365486 agtaagcttctgcgttttggttggtgattcaaggttcggagccaagttagtgggtttggggtttttttcgcccggtggctcttctttctcttttcagatt 32365585  T
118 caaaataggttggttcattgtcttctcggtggatcttgcctttcagatctgtttaggctcag 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||    
32365586 caaaataggttggttcattgtcttctcggtggatcttgcctttcaaatcggtttaggctcag 32365647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University