View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10667_low_8 (Length: 291)
Name: NF10667_low_8
Description: NF10667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10667_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 179
Target Start/End: Original strand, 32365486 - 32365647
Alignment:
| Q |
19 |
agtaagcttctgcgttttggttggtgattcaaggttcgaagccaagttagtgggtttggggtttt-ttcgcccggtggctcttctttctcttttcagatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32365486 |
agtaagcttctgcgttttggttggtgattcaaggttcggagccaagttagtgggtttggggtttttttcgcccggtggctcttctttctcttttcagatt |
32365585 |
T |
 |
| Q |
118 |
caaaataggttggttcattgtcttctcggtggatcttgcctttcagatctgtttaggctcag |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
32365586 |
caaaataggttggttcattgtcttctcggtggatcttgcctttcaaatcggtttaggctcag |
32365647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University