View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10669_low_2 (Length: 227)
Name: NF10669_low_2
Description: NF10669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10669_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 15 - 212
Target Start/End: Original strand, 34839221 - 34839418
Alignment:
| Q |
15 |
atgaatagccgaattcaagatagatgaagtcagtataaccgaatctttcttgtatatcaagtgatctcatttaatagttcatgccttaaaattttagttt |
114 |
Q |
| |
|
||||||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||||||||||||| || ||| |||||||||||||||| ||| |
|
|
| T |
34839221 |
atgaatagctgaatttaagatagatgaagttagtataaccgaatctttcttatgtatcaagtgatctcatttgatcgttaatgccttaaaattttaattt |
34839320 |
T |
|
| Q |
115 |
tcagacatcgtactacctcccctaacactctttttactgtcttttatcgtataagttgtagttatataacaatgtaatgaatttattataaaagaatt |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34839321 |
tcagacatcgtattacctcccctaacactctttttactgtcttttatcgtataagttgtagttatataacaatgtaatgaatttattataaaagaatt |
34839418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University