View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1066_low_10 (Length: 242)
Name: NF1066_low_10
Description: NF1066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1066_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 22 - 134
Target Start/End: Original strand, 42557433 - 42557545
Alignment:
| Q |
22 |
gttactgtcaaagtttgcagcatttattttcagcttatcgctgattaaatcgattccctagcttagagaaaaatcgtaagtggccctactttgtttgatt |
121 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42557433 |
gttactgtcaaagtttgtagcatttattttcagcttatcgctaattaaatcgattccctagcttagagaaaaatcgtaagtggccctactttgtttgatt |
42557532 |
T |
|
| Q |
122 |
ctctcgtataaac |
134 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42557533 |
ctctcgtataaac |
42557545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University