View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10670_high_8 (Length: 236)
Name: NF10670_high_8
Description: NF10670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10670_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 13 - 233
Target Start/End: Original strand, 40480098 - 40480317
Alignment:
| Q |
13 |
aaggccacctcacaatttcgaattaaaataagagnnnnnnnnnntcaatcagaatgtaaattggttttcatttgtcccctttcatatttgaccaacaaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40480098 |
aaggccacctcacaatttcgaattaaaataagaggaaaaaaaa-tcaatcagaatgtaaattggttttcatttgtcccctttcatatttgaccaacaaaa |
40480196 |
T |
|
| Q |
113 |
tcgaacaaatgaagaagaaatttatgggttgcaattttcttggttatgattgcatgtgtgtagagcaatttttggccggcgatttggtgagtttgaaatc |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40480197 |
tcgaacaaatgaagaagatatttatgggttgcaattttcttggttatgattgcatgtgtgtagagcaatttttggccggcgatttggtgagtttgaaatc |
40480296 |
T |
|
| Q |
213 |
gaggaagaagaagagtatgtt |
233 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40480297 |
gaggaagaagaagagtatgtt |
40480317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University