View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10670_low_11 (Length: 288)
Name: NF10670_low_11
Description: NF10670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10670_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 3 - 280
Target Start/End: Complemental strand, 33273176 - 33272899
Alignment:
| Q |
3 |
tatcttataagattttggtccaatgtttctgcataattcatgccttttggtcatgtacattagccatgatatctcaatcaaatatatggctgcataacag |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33273176 |
tatcttataagattttggtccaatgtttctgcataattcatgccttttggtcatgtacattagccatgatatctcaatcaaatatatggctacataacag |
33273077 |
T |
|
| Q |
103 |
atatgattaactccaaaatccttgattgatttgaagattaagtgataggactgagaatctgagattaaattactttttacatccaaggatatggtaacat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33273076 |
atatgattaactccaaaatccttgattgatttgaagattaagtgataggactgagaatctgagattaaattactttttacatccaaggatatggtaacat |
33272977 |
T |
|
| Q |
203 |
tttgctcacagttcaaaggcatcactttcatgtcacatgtcttgtggacctataaactcactttgtaatattcttctc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
33272976 |
tttgctcacagttcaaaggcatcactttcatgtcacatgtcttgtggacctagaaactcattttgtaatattcttctc |
33272899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University