View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10670_low_12 (Length: 268)
Name: NF10670_low_12
Description: NF10670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10670_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 35613076 - 35613312
Alignment:
| Q |
1 |
ctgatccaaacatgcatatcatcttggagattttaaagattctacttgagattttccacatggacccctcattctaatgaaaagcctatattcatcaaag |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35613076 |
ctgatccaaacatgcgtatcatcttggagattttaaagattcaacttgagattttccacatggacccctcattctaatgaaaagcctatattcatcaaag |
35613175 |
T |
|
| Q |
101 |
gtcatagcaggatagagggcaggtttatctggctttaccaattccttagctggctctattggaatgtcactttttggattgtagaagaaagctaaggaaa |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
35613176 |
gtcatagcagggtagagggcaggtttatctggctttaccaattcttttgctggctctattggaatgtcacttttgggattgtagaagaaggctaaggaaa |
35613275 |
T |
|
| Q |
201 |
ctctctctttgtgtgagtttgctagtactctctgctc |
237 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
35613276 |
ctctctctttgtgtgagtttgctattactctatgctc |
35613312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 37 - 124
Target Start/End: Original strand, 31789746 - 31789833
Alignment:
| Q |
37 |
agattctacttgagattttccacatggacccctcattctaatgaaaagcctatattcatcaaaggtcatagcaggatagagggcaggt |
124 |
Q |
| |
|
|||||| ||||||||||| ||||| || ||||||||||||||||| || || || |||||||||||||| || || ||||| |||||| |
|
|
| T |
31789746 |
agattcaacttgagatttgccacaaggtcccctcattctaatgaagagtctgtactcatcaaaggtcattgctgggtagagtgcaggt |
31789833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University