View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10670_low_13 (Length: 254)
Name: NF10670_low_13
Description: NF10670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10670_low_13 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 36083727 - 36083474
Alignment:
| Q |
1 |
gggtttcacagatccaaagaggaaggatgttgcaatagttagaaagaggatagacatggtaaacaaagagttgaagccattgggtcaaacctgccagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36083727 |
gggtttcacagatccaaagaggaaggatgttgcaatagttagaaagaggatagacatggttaacaaagagttgaagccattgggtcaaacctgccagaaa |
36083628 |
T |
|
| Q |
101 |
aaggttagattttccaactgtttagtactaactgttgtttgcnnnnnnncttttataatatctttacaacataggatttgttcaaggagacaaagtgatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36083627 |
aaggttagattttccaactgtttagtactaactgttgtttgctttttttcttttataatatctttacaacataggatttgttcaaggagacaaagtgatc |
36083528 |
T |
|
| Q |
201 |
ccaatgtgttttgcttttgatataaccacataagtattgcttagcatttagtct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36083527 |
ccaatgtgttttgcttttgatataaccacataagtattgcttagcatttagtct |
36083474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University