View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10670_low_14 (Length: 250)
Name: NF10670_low_14
Description: NF10670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10670_low_14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 45 - 250
Target Start/End: Original strand, 6751547 - 6751751
Alignment:
| Q |
45 |
tgttattataggttgccaatttttatttgttcaatttgaattggcaagtagatcatattaacaaaacgtgtgattatctcaacnnnnnnnntgcgattat |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6751547 |
tgttattataggttgccaatttttatttgttcaatttgaattggcaagtagatcatattaacaaaacgtgtgattatctcaacaaaaaaaatgcgattat |
6751646 |
T |
|
| Q |
145 |
gttgggtgaaatacttgacacagaatgctattgcattttacactcaaaatggccattaaattgaatatttaactgtattttgatgcctttttacatgcta |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6751647 |
gttgggtgaaatacttgacacagaatgctattgcattttacactcaaaatggccattaaattgaata-ttaactgtattttgatgcctttttacatgcta |
6751745 |
T |
|
| Q |
245 |
aaatct |
250 |
Q |
| |
|
|||||| |
|
|
| T |
6751746 |
aaatct |
6751751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University