View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10670_low_16 (Length: 248)
Name: NF10670_low_16
Description: NF10670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10670_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 7 - 222
Target Start/End: Complemental strand, 7874393 - 7874178
Alignment:
| Q |
7 |
ttcttattcaccactccaatttgaaatccaaacgtaccctttttcagatttggttgtgattcaaacggaaaacaagatcgctgctttgaaatggcattga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
7874393 |
ttcttattcaccactccaatttgaaatccaaacgtaccctttttcagatttggttttgattcaaacggaaaacaagatcgctgctttgtaatgccattga |
7874294 |
T |
|
| Q |
107 |
cgcgaattgggttgatcccatgattgatcaaagcttccatgtacagtgagaagacaaaaaatattcgatctgaggaatgtgaatgttgttgtgttatagt |
206 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7874293 |
cgcgaattggattaatcccatgattgatcaaagcttccatgtacagtgagaagacaaaaaatattcgatctgaggaatgtgaatgttgttgtgttatagt |
7874194 |
T |
|
| Q |
207 |
tgtggaagttaagaaa |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7874193 |
tgtggaagttaagaaa |
7874178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University