View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10670_low_18 (Length: 242)
Name: NF10670_low_18
Description: NF10670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10670_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 34975117 - 34975339
Alignment:
| Q |
1 |
cataaaccataagttacctagtaacatgagatctttttattatttttgcaggtgtaccttctcatatctctttgatgctctttcatgtttaccggctttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34975117 |
cataaaccataagttacctagtaacatgggatctttttattatttttgcaggtgtaccttctcatatctctttgatgctctttcatgtttaccggctttg |
34975216 |
T |
|
| Q |
101 |
aacaatgcattcccttcttccttcttttttccagctgcctcaatcttttcttgcgtattaagatcccatgattccttttcctgcatccaacattttagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34975217 |
aacaatgcattcccttcttccttcttttttccagctgcctcaatcttttcttgcgtattaagatcccatgattccttttcctgcatccaacattttagca |
34975316 |
T |
|
| Q |
201 |
atcaatatatctctatctcatcc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34975317 |
atcaatatatctctatctcatcc |
34975339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 55 - 126
Target Start/End: Original strand, 3494365 - 3494436
Alignment:
| Q |
55 |
taccttctcatatctctttgatgctctttcatgtttaccggctttgaacaatgcattcccttcttccttctt |
126 |
Q |
| |
|
||||||||||||||| || || ||| || ||| ||| || | |||||||||||||||||||||||| ||||| |
|
|
| T |
3494365 |
taccttctcatatcttttagaagcttttgcatatttcccagttttgaacaatgcattcccttcttctttctt |
3494436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 55 - 183
Target Start/End: Original strand, 18845358 - 18845486
Alignment:
| Q |
55 |
taccttctcatatctctttgatgctctttcatgtttaccggctttgaacaatgcattcccttcttccttcttttttccagctgcctcaatcttttcttgc |
154 |
Q |
| |
|
|||||| |||||||| || || |||||||||| |||||||||||| ||||| ||||||||||||| ||||| || ||||| || ||||| || || || |
|
|
| T |
18845358 |
taccttgtcatatcttttggaagctctttcatatttaccggctttaaacaaaacattcccttcttctttcttcttaccagcagcttcaattttctcctga |
18845457 |
T |
|
| Q |
155 |
gtattaagatcccatgattccttttcctg |
183 |
Q |
| |
|
||||| | |||||| || ||||| ||||| |
|
|
| T |
18845458 |
gtattcatatcccaagactccttctcctg |
18845486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University