View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10670_low_20 (Length: 240)
Name: NF10670_low_20
Description: NF10670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10670_low_20 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 21 - 240
Target Start/End: Original strand, 3474546 - 3474777
Alignment:
| Q |
21 |
ttgatagaagaatcatannnnnnnagggaagatagaatcataattatatatgtg--tgtggatatgtacatttcaacatataattgattgagcatgtttg |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3474546 |
ttgatagaagaatcatatttttttagggaagatagaatcataattatatatgtgtgtgtggatatgtatatttcaacatataattgattgagcatgtttg |
3474645 |
T |
 |
| Q |
119 |
aggatattatcttatataatttataatttccaaattattgtcatatgggtgtcttcagccttggcc-----------aagcaacagaaacatagcatgta |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||| ||||| |||||| |
|
|
| T |
3474646 |
aggatattatcttatataatttataatttacaaattattgtcatatgagtgtcttcagccttggcccaaagacatcaaagcaacagagacataacatgta |
3474745 |
T |
 |
| Q |
208 |
tataaacaaacaaaaaatcttatatatgtttgt |
240 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
3474746 |
tataaac-aacaaaaaatcttatatatgtttgt |
3474777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University