View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10670_low_23 (Length: 233)
Name: NF10670_low_23
Description: NF10670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10670_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 30885709 - 30885518
Alignment:
| Q |
1 |
aaacagatcgtcttgagctgtggacaatggtgttgctcagccagggcaagtgttgtggctacggtctcagtattgatttcttcgcacaattttgattcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30885709 |
aaacagatcgtcttgagctgtggacaatggtgttgctcagccagggcaagtgtcgtggctacggtctcagtattgatttcttcacacaattttgattcac |
30885610 |
T |
|
| Q |
101 |
ataacatttttagcctgtcaagattatagagatcagcagcagccaatagatgctgcaccatgacagtaaaagagcacacatgtattgagccc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885609 |
ataacatttttagcctgtcaagattatagagatcagcagcagccaatagatgctgcaccatgacagtaaaagagcacacatgtattgagccc |
30885518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 191 - 222
Target Start/End: Complemental strand, 30885206 - 30885175
Alignment:
| Q |
191 |
ccgtttattttgatagagacaactcaccctat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30885206 |
ccgtttattttgatagagacaactcaccctat |
30885175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University