View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10670_low_24 (Length: 228)
Name: NF10670_low_24
Description: NF10670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10670_low_24 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 34974753 - 34974980
Alignment:
| Q |
1 |
ttgtgcccttcggtatagggcttttacgtttctactatcaagctctaacacctacagattaaaacaaaatcctcttaagtcaatggttttcactctgttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34974753 |
ttgtgcccttcggtatagggcttttacgtttctactatcaagctctaacacctacagattacaacaaaatcctcttaagtcaatggttttcactctgttt |
34974852 |
T |
|
| Q |
101 |
ccctttgaattcaactacagaaatataacaaaaataagcagaaaaggaaatttcataaactaacctttgtgcacaacttctctgcctgtttgtagtcctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34974853 |
ccctttgaattcaactacagaaatataacaaaaataagcagaaaaggaaatttcataaactaacctttgtgcacaacttctctgcctgtttgtagtcctt |
34974952 |
T |
|
| Q |
201 |
gagtttcaacttacatgccgcgtcatta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34974953 |
gagtttcaacttacatgccgcgtcatta |
34974980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University