View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10670_low_26 (Length: 217)
Name: NF10670_low_26
Description: NF10670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10670_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 36083383 - 36083180
Alignment:
| Q |
1 |
tgttaaggtgattattcaaaataattgtgtttgaatttgtaagtagaaaattgctatttgaaatttgtcatacacgcttctttttcctttaactttagct |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36083383 |
tgttaatgtgattattcaaaataattgtgtttgaatttgtaagtagaaaattgctatttgaaatttgtcatacacgcttcttttttctttaactttagct |
36083284 |
T |
|
| Q |
101 |
cggtggtaagagattgactttgtaattagaac----tgctgaattcaattttgttggttgtaaaatgtcatttttgcaactttaatttatgataatcttc |
196 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| | || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36083283 |
tggtggtaagagattcactttgtaattggaacacactacttaattcaattttcttggttgtaaaatgtcatttttgcaactttaatttatgataatcttc |
36083184 |
T |
|
| Q |
197 |
cttc |
200 |
Q |
| |
|
|||| |
|
|
| T |
36083183 |
cttc |
36083180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University