View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10671_high_18 (Length: 235)
Name: NF10671_high_18
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10671_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 74 - 192
Target Start/End: Original strand, 13799692 - 13799811
Alignment:
| Q |
74 |
ttgatgtgtgattcagttttgattaatgtaaagtttaattcaatttggttgacaccttttacgttattagatcatatgataa-nnnnnnnaggttctgtt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13799692 |
ttgatgtgtgattcagttttgattaatgtaaagtttaattcaatttggttgacaccttttacgttattagatcatatgataattttttttaggttctgtt |
13799791 |
T |
|
| Q |
173 |
tggtaaaatatatagcggat |
192 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
13799792 |
tggtaaaatatacagcggat |
13799811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University