View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10671_high_18 (Length: 235)

Name: NF10671_high_18
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10671_high_18
NF10671_high_18
[»] chr3 (1 HSPs)
chr3 (74-192)||(13799692-13799811)


Alignment Details
Target: chr3 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 74 - 192
Target Start/End: Original strand, 13799692 - 13799811
Alignment:
74 ttgatgtgtgattcagttttgattaatgtaaagtttaattcaatttggttgacaccttttacgttattagatcatatgataa-nnnnnnnaggttctgtt 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||    
13799692 ttgatgtgtgattcagttttgattaatgtaaagtttaattcaatttggttgacaccttttacgttattagatcatatgataattttttttaggttctgtt 13799791  T
173 tggtaaaatatatagcggat 192  Q
    |||||||||||| |||||||    
13799792 tggtaaaatatacagcggat 13799811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University