View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10671_low_18 (Length: 343)
Name: NF10671_low_18
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10671_low_18 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0009 (Bit Score: 94; Significance: 8e-46; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 146277 - 146180
Alignment:
| Q |
20 |
aaaatttcctccttacggtatagactttgatggtggcaaacctactggtcgatacactaatggaaaaactgtggttgattacttaggtgagaaaacac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
146277 |
aaaatttcctccttacggtatagactttgatggtggcaaacctactggtcgaaacactaatggaaaaactgtggttgattacttaggtgagaaaacac |
146180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 61; Significance: 4e-26; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 20 - 116
Target Start/End: Complemental strand, 36700325 - 36700229
Alignment:
| Q |
20 |
aaaatttcctccttacggtatagactttgatggtggcaaacctactggtcgatacactaatggaaaaactgtggttgattacttaggtgagaaaaca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
36700325 |
aaaatttcctccttacggtatagactttggtggtgccaaacctactggtcgatgcactaatggaaaaacaactgttgtttacataggtgagaaaaca |
36700229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 265 - 321
Target Start/End: Complemental strand, 36700218 - 36700162
Alignment:
| Q |
265 |
attctcttttctcaaattaatattggtattgatgtgtagtgtctagtgtccggactt |
321 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
36700218 |
attctcttttctcaaattaatatcggtattgatgtgtagtgtccagtgtccggactt |
36700162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University