View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10671_low_29 (Length: 300)
Name: NF10671_low_29
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10671_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 16 - 118
Target Start/End: Original strand, 1647313 - 1647415
Alignment:
| Q |
16 |
aagctgaggttgacaagccacttggtctcactttaggccaaaagaatggtggcggtgttgttataacggtcagtatctcgctcaatttcccattaattca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1647313 |
aagctgaggttgacaagccacttggtctcactttaggccaaaagaatggtggcggtgttgttataacggtcagtatctcgctcaatttcccattaattca |
1647412 |
T |
|
| Q |
116 |
atg |
118 |
Q |
| |
|
||| |
|
|
| T |
1647413 |
atg |
1647415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 164 - 290
Target Start/End: Original strand, 1647417 - 1647553
Alignment:
| Q |
164 |
ttgaaggcatgtctggtatccgacataagcgacacgacaccgacacatatggttaaattccaatatttcacgttctcaaaatattatt----------tg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1647417 |
ttgaaggcatgtctggtatccgacataagcgacacgacactgacacatatggttaaattccaatatttcacgttctcaaaatattatttgcgtcgatgtg |
1647516 |
T |
|
| Q |
254 |
tcagtgttgtttcctatgtctgatatccttgtctgtg |
290 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
1647517 |
tcagtgttgtgtcctatgtctaatatccttgtctgtg |
1647553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University