View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10671_low_30 (Length: 291)
Name: NF10671_low_30
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10671_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 40 - 277
Target Start/End: Original strand, 8018911 - 8019148
Alignment:
| Q |
40 |
tccatattttctttgttatacccaatatttaatcataatacattggaaaattgaacnnnnnnntatataattagattgcatggccctagtattatcccaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
8018911 |
tccatattttctttgttatacccaatatttaatcataatacattggaaaattgaacaaaaaaatataaaattagattgcatggccttagtattatcccaa |
8019010 |
T |
|
| Q |
140 |
gttttctctcccataatcagagtgtcatcaacaaaatgcaaacaagaaatatgcagcttcaatgaagagtcaaccttgtactcgatagacaactcagcct |
239 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
8019011 |
gttttctctcccataatcatagtgtcgtcaacaaaatgcaaacaagaaatatgcaacttcaatgaagagtcaaccttgtgctcgatagacagctcagcct |
8019110 |
T |
|
| Q |
240 |
caactgaagcattcaacataacattcataccttcaaaa |
277 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8019111 |
caactgaaacattcaacataacattcataccttcaaaa |
8019148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University