View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10671_low_32 (Length: 286)
Name: NF10671_low_32
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10671_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 20 - 280
Target Start/End: Complemental strand, 9939434 - 9939177
Alignment:
| Q |
20 |
catttaacttttgcaaaacaaattataagcactaaaatttgaagaatgctatgttttcattcccaaagtaccctgcatattaaagagtaaaacaagtacg |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9939434 |
catttagcttttgcaaaacaaattataagcactaaaatttgaagaatgctatgttttcattcccaaagtaccctgcatattaaagagtaaaacaagtacg |
9939335 |
T |
|
| Q |
120 |
ttcattaattatccaagttaagaccatagacaatgatgtttaaatatccaattttgttagctgcatgtatcatgatgtttaaatatccaactatggacgc |
219 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
9939334 |
ttcattgattttccaagttaagaccatagacaatgatgtttaaatatccaattttgttagctgcatgtatc---atgtttaaatatccaaccatggacgc |
9939238 |
T |
|
| Q |
220 |
caccatctccgcgtcaaaacaagaccggaagtcgaccaacaccagcgctcctctctgctcc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
9939237 |
caccatctccgcgtcaaaacaagaccggaattcgaccaacaccagcgctcctctctactcc |
9939177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University