View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10671_low_41 (Length: 250)

Name: NF10671_low_41
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10671_low_41
NF10671_low_41
[»] chr7 (4 HSPs)
chr7 (112-244)||(22887116-22887249)
chr7 (9-108)||(22838188-22838287)
chr7 (1-97)||(22806914-22807010)
chr7 (133-244)||(22807021-22807131)
[»] chr1 (1 HSPs)
chr1 (168-244)||(21152616-21152692)


Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 112 - 244
Target Start/End: Original strand, 22887116 - 22887249
Alignment:
112 tgttcttattgtctacgaaaatggtagaggtattctatacttagggctttggtcaatttactctcaaattgtttctaacaaactaatgtggtttaaa-tt 210  Q
    |||||||||||||||| | ||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||| ||||||||||| ||| | ||| ||    
22887116 tgttcttattgtctacaagaatggtaaaggtattctttacctagggctttggtcaatttactctcaaattgtttcaaacaaactaatttggctgaaattt 22887215  T
211 tcttaatttcagggatcactttagaggtatgagt 244  Q
    | |||||||||||||||| |||||| ||||||||    
22887216 ttttaatttcagggatcattttagaagtatgagt 22887249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 9 - 108
Target Start/End: Original strand, 22838188 - 22838287
Alignment:
9 tgcaaaccagactcaaatcctcaacaacctttccttgccataaccagggcatcaagaactttacgtattcaatgcctctaatgcaatttggattataatg 108  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||| || || || |||||||||||| |||||    
22838188 tgcaaaccatactcaaatcatcaacaacctttccttgccataaccagggcttcaagaattttacgtattcaaagcttcaaaggcaatttggattctaatg 22838287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 22806914 - 22807010
Alignment:
1 gattctaatgcaaaccagactcaaatcctcaacaacctttccttgccataaccagggcatcaagaactttacgtattcaatgcctctaatgcaattt 97  Q
    ||||| ||||| ||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||| | ||||||||| | ||||||||||    
22806914 gattcaaatgcgaaccagagtcaaatcctcaacaacctttccttgccataagcagggcttcaagaactttacatcttcaatgccgcaaatgcaattt 22807010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 133 - 244
Target Start/End: Original strand, 22807021 - 22807131
Alignment:
133 tggtagaggtattctatacttagggctttggtcaatttactctcaaattgtttctaacaaactaatgtggtttaaatttcttaatttcagggatcacttt 232  Q
    ||||| ||||||||| ||| |||||||||||||| ||||||||||||||||||| ||||||||||||||| || ||||  |||||||||||||||| ||     
22807021 tggtaaaggtattctttacctagggctttggtcagtttactctcaaattgtttcaaacaaactaatgtgg-ttgaattatttaatttcagggatcattta 22807119  T
233 agaggtatgagt 244  Q
    ||| ||||||||    
22807120 agaagtatgagt 22807131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 168 - 244
Target Start/End: Complemental strand, 21152692 - 21152616
Alignment:
168 tttactctcaaattgtttctaacaaactaatgtggtttaaatttcttaatttcagggatcactttagaggtatgagt 244  Q
    |||| |||||||||||||| ||||||||||||||||| |||||| |||||||||||||||| |||||| ||||||||    
21152692 tttattctcaaattgtttcaaacaaactaatgtggttgaaattttttaatttcagggatcattttagaagtatgagt 21152616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University