View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10671_low_42 (Length: 249)
Name: NF10671_low_42
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10671_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 121 - 239
Target Start/End: Complemental strand, 25290673 - 25290555
Alignment:
| Q |
121 |
gatgatagattaaaacgcattcgattcgaagtgcgcatgataatattgataagactttgaaagctgcggaggtgattttggggcagtttgatcagacgcg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25290673 |
gatgatagattaaaacgcattcgattcgaagtgcgcatgataatattgataagactttgaaagctgcggaggtgattttggggcagtttgatcagacgcg |
25290574 |
T |
 |
| Q |
221 |
taaggtgtgtatgtctctg |
239 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25290573 |
taaggtgtgtatgtctctg |
25290555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 50
Target Start/End: Complemental strand, 25290760 - 25290732
Alignment:
| Q |
22 |
tcctactcaggtaatgtgaattggatcaa |
50 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25290760 |
tcctactcaggtaatgtgaattggatcaa |
25290732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University