View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10671_low_44 (Length: 244)
Name: NF10671_low_44
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10671_low_44 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 15 - 153
Target Start/End: Original strand, 10818026 - 10818164
Alignment:
| Q |
15 |
tatatatggtatgtgtcttaattttcccacaatgtgatatcgtaaaatgtgttattaatgtctcttgtgatgcagattgaatgcctagtagatcagatat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10818026 |
tatatatggtatgtgtcttaattttcccacaatgtgatatcgtaaaatgtgttattaatgtctcttgtgatgcagattgaatgcctagtagatcacatat |
10818125 |
T |
|
| Q |
115 |
gcaacatgacaataatgtcactagacacatggtatgttt |
153 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10818126 |
gcaacgtgacaataatgtcactagacacatggtatgttt |
10818164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 175 - 235
Target Start/End: Original strand, 10818472 - 10818532
Alignment:
| Q |
175 |
atgattatatattcttaatatttaaatttggtttgaaaaatatgttcctgattattcttct |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10818472 |
atgattatatattcttaatatttaaatttggtttgaaaaatatgttcctgattattcttct |
10818532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University