View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10671_low_45 (Length: 243)
Name: NF10671_low_45
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10671_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 41852376 - 41852582
Alignment:
| Q |
19 |
atgtttagttgtgtggcttgacagctaaggtgcattatggaacttctttgtccaatgtggattggttacatggtggggctgagtcccttctcactctcac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41852376 |
atgtttagttgtgtggcttgacagctaaggtgcattatggaacttctttgtccaatgtggattggttacatggtggggctgagtcccttctcactctcac |
41852475 |
T |
 |
| Q |
119 |
aaacttgttcattgtgttgggtttgagagagggaatcagaaaagctgacaattcggagaaaaacacggaaccgaaggaagagaagaaacctgggatgaag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
41852476 |
taacttgttcattgtgttgggtttgagagagggaatcagaaaagctgaaaattcggagaaaaacactgaatcgaaggaagagaagaaacctgggatgaag |
41852575 |
T |
 |
| Q |
219 |
gtctgat |
225 |
Q |
| |
|
||||||| |
|
|
| T |
41852576 |
gtctgat |
41852582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University