View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10671_low_57 (Length: 231)
Name: NF10671_low_57
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10671_low_57 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 28 - 218
Target Start/End: Complemental strand, 3324849 - 3324659
Alignment:
| Q |
28 |
tatttaatttaccccaacatatcctctaaaatatccaacatcaacaagaaaagacatttccctttttagccaatagggtctcctcatatattctatgata |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3324849 |
tatttaatttaccccaacatatcctctaaaatatccaacatcaacaagaaaagacatttccctttttagccaatagggtctcctcatatattctatgata |
3324750 |
T |
|
| Q |
128 |
caaatgtttcgatggttattgaagcctaagttctattcaaaatggtacaatacaacactaaccagtaactaaaattgtgatttttaattct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3324749 |
caaatgtttcgatggttattgaagcctaagttctattcaaaatggtacaatataacactaaccaataactaaaattgtgatttttaattct |
3324659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University