View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10671_low_61 (Length: 223)
Name: NF10671_low_61
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10671_low_61 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 25797327 - 25797116
Alignment:
| Q |
1 |
tttcactagacacaaggaaataaaccaaaacttaagcacacaatattatttaaatctaaaattagaaagatatttttggtgttattcctccggtttacgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
25797327 |
tttcactagacacaaggaaataaaccaaaacttaagcacacaatattatttaaatctaaaattagaaagatatttttggtgttaatcctccggtttacag |
25797228 |
T |
|
| Q |
101 |
gggaagggctcctggtaatacgaagttcgaccaggaggtaagtaaaaagtctgaccaagaattttgttccatccagaaattgtgcgcagactcttctgaa |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25797227 |
gagaagggctcctggtaatacgaagttcgaccaggaggtaagtaaaaagtctgaccaagaa--ttgttccatccagaaattgtgcgcagactcttctgaa |
25797130 |
T |
|
| Q |
201 |
caatttgtcctttg |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25797129 |
caatttgtcctttg |
25797116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University