View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10671_low_62 (Length: 221)
Name: NF10671_low_62
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10671_low_62 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 8622212 - 8622432
Alignment:
| Q |
1 |
tatactatactatatttttatgcaccgtttagaaaaacttgttgagtcattttccaatacataaaacaattttggattgnnnnnnncaatgtcgaggacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
8622212 |
tatactatactatatttttatgcaccgtttagaaaaacttgttgagtcattttccaatacataaaacaattttggattgtttttttcaatgttgaggacg |
8622311 |
T |
|
| Q |
101 |
aacacaaacctctcgctgacattctttttatttcatttcttaacaaaacaattacgacttttaaataaaagtatgcatgaagcactggaatatccaacgc |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8622312 |
aacacaaaactctcgctgacattctttttatttcatttcttaacaaaacaattacgacttttaaataaaagtatgcatgaagcactggaatatccaacgc |
8622411 |
T |
|
| Q |
201 |
atattatgcaaattgtcaaat |
221 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
8622412 |
atattacgcaaattgtcaaat |
8622432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University