View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10671_low_66 (Length: 212)
Name: NF10671_low_66
Description: NF10671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10671_low_66 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 8 - 204
Target Start/End: Original strand, 34040925 - 34041118
Alignment:
| Q |
8 |
agaagcagagagggaggttgacgatgttgactccaagttcaacttgcatcttccaccaggtgaagctggtgttgatgaaggacagtacagaaggccaaaa |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
34040925 |
agaatcagagagggaggttgacgatgttgactccaagttcaacttacattttccaccaggtgaagctggtgttgatg---gacagtacaaaaggccaaaa |
34041021 |
T |
|
| Q |
108 |
aggaagtcaatgtatagcactttcagtaaggcaggtctgtgggaggtcgcaagcagatttgggtgtagttctgagcaactcggatgatgtccatctc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
34041022 |
aggaagtcaatgtatagcactttcagtaaggcaggtctgtgggaggttgcaagcagatttgggtgtagttctgagcaactcggattatgtctatctc |
34041118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 8 - 204
Target Start/End: Complemental strand, 34586044 - 34585848
Alignment:
| Q |
8 |
agaagcagagagggaggttgacgatgttgactccaagttcaacttgcatcttccaccaggtgaagctggtgttgatgaaggacagtacagaaggccaaaa |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||| | ||| | ||||| ||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
34586044 |
agaatcagagagggaggttgacgatgttgattccaagttcaatgtacatttcccacctggtgaagctggtgttgatgaaggacagtacaaaaggccgaaa |
34585945 |
T |
|
| Q |
108 |
aggaagtcaatgtatagcactttcagtaaggcaggtctgtgggaggtcgcaagcagatttgggtgtagttctgagcaactcggatgatgtccatctc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||| |||||||| |||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
34585944 |
aggaagtcaatgtatagcactttcagtaaggcgggcctgtgggaggttgcaagcaggtttgggtgtagttctgagcaactcggattatgtctatctc |
34585848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University