View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10672_6 (Length: 369)
Name: NF10672_6
Description: NF10672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10672_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 25 - 61
Target Start/End: Original strand, 44911522 - 44911558
Alignment:
| Q |
25 |
tgtgtgaaaataaaatggacatgaattgaagagtctt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44911522 |
tgtgtgaaaataaaatggacatgaattgaagagtctt |
44911558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University