View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10672_9 (Length: 305)
Name: NF10672_9
Description: NF10672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10672_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 183 - 285
Target Start/End: Complemental strand, 1647415 - 1647313
Alignment:
| Q |
183 |
cattgaattaatgggaaattgagcgagatactgaccgttataacaacaccgccaccattcttttggcctaaagtgagaccaagtggcttgtcaacctcag |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1647415 |
cattgaattaatgggaaattgagcgagatactgaccgttataacaacaccgccaccattcttttggcctaaagtgagaccaagtggcttgtcaacctcag |
1647316 |
T |
|
| Q |
283 |
ctt |
285 |
Q |
| |
|
||| |
|
|
| T |
1647315 |
ctt |
1647313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 11 - 137
Target Start/End: Complemental strand, 1647553 - 1647417
Alignment:
| Q |
11 |
cacagacaaggatatcagacataggaaacaacactgaca----------aataatattttgagaacgtgaaatattggaatttaaccatatgtgtcggtg |
100 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1647553 |
cacagacaaggatattagacataggacacaacactgacacatcgacgcaaataatattttgagaacgtgaaatattggaatttaaccatatgtgtcagtg |
1647454 |
T |
|
| Q |
101 |
tcgtgtcgcttatgtcggataccagacatgccttcaa |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1647453 |
tcgtgtcgcttatgtcggataccagacatgccttcaa |
1647417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University