View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10672_low_13 (Length: 224)
Name: NF10672_low_13
Description: NF10672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10672_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 34532418 - 34532623
Alignment:
| Q |
1 |
cgtatttactttgaaggctgtatccaaattgaggatttagtttccttccggtcatattattaaggtaatagaaaagagaaggnnnnnnnn-gacgcaaat |
99 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34532418 |
cgtatttactttgaaggctgtgtccaaattgacgatttagtttccttccagtcatattattaaggtaatagaaaagagaagaagaaaaaaagacgcaaat |
34532517 |
T |
 |
| Q |
100 |
gattacaatgataaaaatgagctttaccatgtttttgagtatatagtgcatacatgtgtcttgtaggtggtgcctgctcaggattcagtaggcacattca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34532518 |
gattacaatgataaaaatgagctttaccatgtttttgagtatatagtgcatacatgtgtcttgtaggtggtgcctgctcaggattcagtaggcacattca |
34532617 |
T |
 |
| Q |
200 |
caacac |
205 |
Q |
| |
|
|||||| |
|
|
| T |
34532618 |
caacac |
34532623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University