View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10673_high_3 (Length: 267)
Name: NF10673_high_3
Description: NF10673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10673_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 2 - 248
Target Start/End: Original strand, 880201 - 880447
Alignment:
| Q |
2 |
atcgcgacctttccctttctcccctcccttgcgccctccattctcacgacaaactccttcttccctgttatcttcaaatttaacttcttcgccatcacct |
101 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
880201 |
atcgctacctttccctttctcccctcccttgcgccctccattctcacgacaaactccttcttccctgttatcttcaaatttaacttcttccccatcacct |
880300 |
T |
|
| Q |
102 |
caagtttctccaacattgttgaagccgaaaactttgatataaacatcgatggcaacctcttcctcgtctcaaataaactcctaagatcaaaaccatgtga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
880301 |
caagtttctccaacattgttgaagccgaaaactttgatataaacatcgatggcaacctcttcctcgtctcaaataaactcctaagatcaaaaccatgtga |
880400 |
T |
|
| Q |
202 |
caacgatgaaattatctcgaatgcattataaaaaggacgagacggtt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
880401 |
caacgatgaaattatctcgaatgcattataaaaaggacgagacggtt |
880447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 228
Target Start/End: Original strand, 45267812 - 45267918
Alignment:
| Q |
122 |
gaagccgaaaactttgatataaacatcgatggcaacctcttcctcgtctcaaataaactcctaagatcaaaaccatgtgacaacgatgaaattatctcga |
221 |
Q |
| |
|
||||| || ||||| |||||||||||||| ||| | ||||||||||||||||| ||| |||| |||||||| |||||||| || |||||||||||||| | |
|
|
| T |
45267812 |
gaagcagacaacttggatataaacatcgaaggcgatctcttcctcgtctcaaacaaattccttagatcaaatccatgtgataaagatgaaattatctcaa |
45267911 |
T |
|
| Q |
222 |
atgcatt |
228 |
Q |
| |
|
||||||| |
|
|
| T |
45267912 |
atgcatt |
45267918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University