View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10673_high_7 (Length: 244)
Name: NF10673_high_7
Description: NF10673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10673_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 37212995 - 37212763
Alignment:
| Q |
1 |
ttctctaaaaaatattatctgtcttgttattttaaatttaacactaacttcaacttgttgccttgtggatatgttcagtcagagtctagggattgccccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37212995 |
ttctctaaaaaatattatctgtcttgttattttaaatttaacactaacttcaacttgttgccttgtggatatgttcagtcagagtctagggattgccctg |
37212896 |
T |
|
| Q |
101 |
tctctactagaaggcgattaaatttggattccacaatgatttctgatctccgtcgcactttgagatcttctgg--------gctctttgagatcctctaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37212895 |
tctctactagaaggcgattaaatttggattccacaatgatttctgatctccgttgcactttgagatcttctggtcgccgatgctctttgagatcctctaa |
37212796 |
T |
|
| Q |
193 |
aatgcctgttgaaaccggaacaacatctttgtc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37212795 |
aatgcctgttgaaaccggaacaacatctttgtc |
37212763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 48 - 225
Target Start/End: Complemental strand, 37218299 - 37218112
Alignment:
| Q |
48 |
cttcaacttgttgccttgtgg--atatgttcagtcagagtctagggattgccccgtctctactagaaggcgattaaatttggattccacaatgatttctg |
145 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| ||||| ||||||||||| ||| || |||||| | ||||||| | |||||||||||||||| |
|
|
| T |
37218299 |
cttcaatttgttgccttgtgtgtatatgttcagttagagtatagggattgccgtgtcactcctagaaagaaattaaatccaaagtccacaatgatttctg |
37218200 |
T |
|
| Q |
146 |
atctccgtcgcactttgagatcttctgg--------gctctttgagatcctctaaaatgcctgttgaaaccggaacaacatctttgtc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37218199 |
atctccgtcgcactttgagatcttctggtcgccgatgctctttgagatcctctaaaatgcctgttgaaaccggaacaacatctttgtc |
37218112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 105
Target Start/End: Complemental strand, 37203664 - 37203611
Alignment:
| Q |
52 |
aacttgttgccttgtggatatgttcagtcagagtctagggattgccccgtctct |
105 |
Q |
| |
|
||||| |||||||||| |||||||||||| |||||| |||||||||| |||||| |
|
|
| T |
37203664 |
aacttcttgccttgtgtatatgttcagtctgagtcttgggattgccctgtctct |
37203611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Complemental strand, 37184695 - 37184657
Alignment:
| Q |
49 |
ttcaacttgttgccttgtggatatgttcagtcagagtct |
87 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
37184695 |
ttcaacttgttgccttgtgcatatgttcagtcacagtct |
37184657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 224
Target Start/End: Complemental strand, 7528571 - 7528524
Alignment:
| Q |
177 |
ctttgagatcctctaaaatgcctgttgaaaccggaacaacatctttgt |
224 |
Q |
| |
|
|||||||||| ||||||| ||||||| |||| |||||||||||||||| |
|
|
| T |
7528571 |
ctttgagatcgtctaaaacgcctgttaaaactggaacaacatctttgt |
7528524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University