View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10673_high_8 (Length: 242)
Name: NF10673_high_8
Description: NF10673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10673_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 17 - 205
Target Start/End: Original strand, 28895541 - 28895729
Alignment:
| Q |
17 |
cattatagttgctatctagcaacactttatagcatcgacatttttgatggaagacatgtccggtggttaccgataccaacacatgcaattacattcaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28895541 |
cattatagttgctatctagcaacactttatagcaccggcatttttgatggaagacatgtccggtggttaccgataccaacacatgcaattacattcaatt |
28895640 |
T |
 |
| Q |
117 |
agttctttacataagtgcgatgtgtgtcactgtgtcgatacttcaatacataaacaatcaactattaaaatgtactattgtgtttctat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28895641 |
agttctttacataagtgcgatgtgtgtcactgtgtcgatacttcaatacataaacaatcaattattaaaatgtactattgtgtttctat |
28895729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 39 - 124
Target Start/End: Original strand, 28897318 - 28897403
Alignment:
| Q |
39 |
cactttatagcatcgacatttttgatggaagacatgtccggtggttaccgataccaacacatgcaattacattcaattagttcttt |
124 |
Q |
| |
|
|||||||| ||| ||||| ||||| || |||| |||||||| ||||||||||||||| | |||||||| |||||||||| |||||| |
|
|
| T |
28897318 |
cactttatggcaccgacacttttggtgaaagatatgtccggcggttaccgataccaaaagatgcaattgcattcaattaattcttt |
28897403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University