View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10673_low_14 (Length: 235)
Name: NF10673_low_14
Description: NF10673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10673_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 24893650 - 24893422
Alignment:
| Q |
1 |
agaaaattactttcaccttctacttctacttaccactcatcaaaaactctaaaatgagtttcattacaccccacaacattacaccccttttcaaatcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24893650 |
agaaaattactttcaccttctacttctacttaccactcatcaaaaactctaaaatgagtttcattacaccccacaacattacaccccttttcaaatcttg |
24893551 |
T |
|
| Q |
101 |
tatgtggaggctttagtgcatcgagcttcgcagtttgatgatgaaatcgagttgttcttaatgaaattatttcctaatattttctattcaacatgctcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24893550 |
tatgtggaggctttagtgcatcgagcttcgcagtttgatgatgaaatcgagttgttcttaatgaaattatttgctaatattttctattcaacatgctcat |
24893451 |
T |
|
| Q |
201 |
cttttgggtttgtttctcacctatgctac |
229 |
Q |
| |
|
|||||||||||||||||||| | |||||| |
|
|
| T |
24893450 |
cttttgggtttgtttctcacttttgctac |
24893422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 162 - 220
Target Start/End: Complemental strand, 24903668 - 24903610
Alignment:
| Q |
162 |
tgaaattatttcctaatattttctattcaacatgctcatcttttgggtttgtttctcac |
220 |
Q |
| |
|
||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24903668 |
tgaaattgttacctaataccttctattcaacatgctcatcttttgggtttgtttctcac |
24903610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University