View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10674_low_4 (Length: 271)
Name: NF10674_low_4
Description: NF10674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10674_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 2 - 252
Target Start/End: Original strand, 28104069 - 28104319
Alignment:
| Q |
2 |
cagtttgtgttattcgagtcagtggtgttctgctgtatttctttttgcgttttgctgccttggtttattttcctggtcactccaaatccttttggacggt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28104069 |
cagtttgtgttattcgagtcagtggtgttctgctgtatttctttttgcgttttgctgccttggtttattttcctggtcactccaaatccttttggacggt |
28104168 |
T |
|
| Q |
102 |
tgtgccaattttgtttttgagcggtggtgtggtgtgttggcaggtttggctatgaacggtggtttttggtcagcagattttgtactgcacagtggctttt |
201 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28104169 |
tgtgccagttttgtttttgagcggtggtgtggtgtgttggcaggtttggctatgaacggtggtttttggtcagcagattttgtactgcacagtggctttt |
28104268 |
T |
|
| Q |
202 |
tgttcttgctgcaattcattttatggctgctatattttttgctacggtttt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28104269 |
tgttcttgctgcaattcattttatggctgctatattttttgctacggtttt |
28104319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 2 - 238
Target Start/End: Original strand, 26640995 - 26641228
Alignment:
| Q |
2 |
cagtttgtgttattcgagtcagtggtgttctgctgtatttctttttgcgttttgctgccttggtttattttcctggtcactccaaatccttttggacggt |
101 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| || ||| |||||| ||| ||||||||||||||| ||||||||||||||||||| ||||||| || |
|
|
| T |
26640995 |
cagtttgtattatttgagtcagtggtgttctgttgcatta-tttttgtgtt---ctgccttggtttattgtcctggtcactccaaatccgtttggactgt |
26641090 |
T |
|
| Q |
102 |
tgtgccaattttgtttttgagcggtggtgtggtgtgttggcaggtttggctatgaacggtggttttt-ggtcagcagattttgtactgcacagtggcttt |
200 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||| |||||||||||||||| | | |||||||||| | || ||||||||||||| ||| ||||||||| |
|
|
| T |
26641091 |
tgtgccagttttgattttgagcggtggtgtggtgcgttggcaggtttggctttaagtggtggtttttcgatctgcagattttgtaccgcatagtggcttt |
26641190 |
T |
|
| Q |
201 |
ttgttcttgctgcaattcattttatggctgctatattt |
238 |
Q |
| |
|
|||| ||||||||||| |||| || ||||||||||||| |
|
|
| T |
26641191 |
ttgtacttgctgcaatgcattctaaggctgctatattt |
26641228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University