View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10674_low_8 (Length: 216)

Name: NF10674_low_8
Description: NF10674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10674_low_8
NF10674_low_8
[»] chr8 (1 HSPs)
chr8 (1-200)||(36869127-36869326)


Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 36869326 - 36869127
Alignment:
1 aaaaactgataaaagacatgtgnnnnnnntgagaataattaacacattctattgattgaaggcttctctataatgatttacctattgcacagcgacttgt 100  Q
    ||||||||||||||||| ||||       ||||||||||| ||||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||    
36869326 aaaaactgataaaagacgtgtgaaaaaaatgagaataatttacacattatgttgattgaaggcttctctataatgatttacctatcgcacagcgacttgt 36869227  T
101 gaattgtaatcagttacaaagccaatcttgcacttaaagaaatgagttgaaataggcgaatattttattaaacttttgcagttctctgtagtattgtctg 200  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
36869226 gaattgtaatcaattacaaagccaatcttgcacttaaagaaatgagttgaaataggcgaatattttattaaacttctgcagttctctgtagtattgtctg 36869127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University