View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10675_high_3 (Length: 254)

Name: NF10675_high_3
Description: NF10675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10675_high_3
NF10675_high_3
[»] chr2 (4 HSPs)
chr2 (18-64)||(26736049-26736095)
chr2 (164-209)||(26735840-26735885)
chr2 (30-64)||(26736139-26736173)
chr2 (226-254)||(22699451-22699479)
[»] chr6 (1 HSPs)
chr6 (226-254)||(16765036-16765064)
[»] chr5 (1 HSPs)
chr5 (226-254)||(14647978-14648006)


Alignment Details
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 26736095 - 26736049
Alignment:
18 tgattgatgcacaattcaagttattacaaactattagttatatctag 64  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
26736095 tgattgatgcacaattcaagttattacaaactattagttatatctag 26736049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 164 - 209
Target Start/End: Complemental strand, 26735885 - 26735840
Alignment:
164 gcaggttttggaggaaatgacaacattattactcgaagcttacgct 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
26735885 gcaggttttggaggaaatgacaacattattactcgaagcttacgct 26735840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 64
Target Start/End: Original strand, 26736139 - 26736173
Alignment:
30 aattcaagttattacaaactattagttatatctag 64  Q
    |||||||||||||||||||||| ||||||||||||    
26736139 aattcaagttattacaaactataagttatatctag 26736173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 226 - 254
Target Start/End: Original strand, 22699451 - 22699479
Alignment:
226 tttttggcttaattgtacttttggacccc 254  Q
    |||||||||||||||||||||||||||||    
22699451 tttttggcttaattgtacttttggacccc 22699479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 226 - 254
Target Start/End: Original strand, 16765036 - 16765064
Alignment:
226 tttttggcttaattgtacttttggacccc 254  Q
    |||||||||||||||||||||||||||||    
16765036 tttttggcttaattgtacttttggacccc 16765064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 226 - 254
Target Start/End: Complemental strand, 14648006 - 14647978
Alignment:
226 tttttggcttaattgtacttttggacccc 254  Q
    |||||||||||||||||||||||||||||    
14648006 tttttggcttaattgtacttttggacccc 14647978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University