View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10675_low_15 (Length: 204)
Name: NF10675_low_15
Description: NF10675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10675_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 14 - 186
Target Start/End: Complemental strand, 22091472 - 22091298
Alignment:
| Q |
14 |
cagagacattaatatgcat-tagtcaatgatcttaggttaggtatcagatggggtt-agccttcttataggttgaggcgctgccacttcatcgaagttta |
111 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22091472 |
cagagacattaatatgcatgtagtcaatgatcttaggttagatatcagatggggtttagccctcttataggttgaggcgctgccacttcatcgaagttta |
22091373 |
T |
|
| Q |
112 |
gctgatcctgctgccacttcatcgatgtccccgtgtttttcaaccatttaggactaatgccttaagtaatgagtg |
186 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22091372 |
gctgatcctgctgccacttcatcgaagtccccgtgtttttcaaccatttaggactaatgccttaagtaatgagtg |
22091298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University