View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10675_low_6 (Length: 254)
Name: NF10675_low_6
Description: NF10675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10675_low_6 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 26736095 - 26736049
Alignment:
| Q |
18 |
tgattgatgcacaattcaagttattacaaactattagttatatctag |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26736095 |
tgattgatgcacaattcaagttattacaaactattagttatatctag |
26736049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 164 - 209
Target Start/End: Complemental strand, 26735885 - 26735840
Alignment:
| Q |
164 |
gcaggttttggaggaaatgacaacattattactcgaagcttacgct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26735885 |
gcaggttttggaggaaatgacaacattattactcgaagcttacgct |
26735840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 64
Target Start/End: Original strand, 26736139 - 26736173
Alignment:
| Q |
30 |
aattcaagttattacaaactattagttatatctag |
64 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
26736139 |
aattcaagttattacaaactataagttatatctag |
26736173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 226 - 254
Target Start/End: Original strand, 22699451 - 22699479
Alignment:
| Q |
226 |
tttttggcttaattgtacttttggacccc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22699451 |
tttttggcttaattgtacttttggacccc |
22699479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 226 - 254
Target Start/End: Original strand, 16765036 - 16765064
Alignment:
| Q |
226 |
tttttggcttaattgtacttttggacccc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16765036 |
tttttggcttaattgtacttttggacccc |
16765064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 226 - 254
Target Start/End: Complemental strand, 14648006 - 14647978
Alignment:
| Q |
226 |
tttttggcttaattgtacttttggacccc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14648006 |
tttttggcttaattgtacttttggacccc |
14647978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University