View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10675_low_8 (Length: 234)
Name: NF10675_low_8
Description: NF10675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10675_low_8 |
 | |
|
| [»] scaffold0016 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 15 - 205
Target Start/End: Complemental strand, 27245284 - 27245094
Alignment:
| Q |
15 |
caaaggattaaaacaaattttagtaccgttaaaaaagaaacaattcttactaaatcaaggcatggtgatggaacattgctttacctctatgctaaaggat |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27245284 |
caaaggattaaaacaaattttagtactgttaaaaaagaaacaattcttactaaatcaaggcatggtgatggaacattgctttacctctatgctaaaggat |
27245185 |
T |
|
| Q |
115 |
cattgctttttcttcataagactctatggactttttacacctatcgcataatcataattgatcttgaagcataacacatgtatttgaatca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27245184 |
cattgctttttcttcataagactctatggactttttacacctattgcataatcataattgatcttgaagcataacacatgtatttgaatca |
27245094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 15 - 109
Target Start/End: Complemental strand, 40995 - 40896
Alignment:
| Q |
15 |
caaaggattaaaacaaattttagtaccgttaaaaaagaa---acaattctt--actaaatcaaggcatggtgatggaacattgctttacctctatgctaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40995 |
caaaggattaaaacaaattttagtactgttaaaaaaaaaggaacaattcttttactaaatcaaggcatggtgatggaacattgctttacctctatgctaa |
40896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University