View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10676_high_1 (Length: 239)
Name: NF10676_high_1
Description: NF10676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10676_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 4 - 230
Target Start/End: Complemental strand, 39814112 - 39813886
Alignment:
| Q |
4 |
atattttcctctgttgtttcactaatgcatgcaacaagaggactctcatttggtacaacatcatctctttggtagcttcctggacctctaagcaattctt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39814112 |
atattttcctctgttgtttcactaatgcatgcaacaagaggactctcatttggtacaacatcatctctttggtagcttcctggacctctaagcaattctt |
39814013 |
T |
|
| Q |
104 |
ctgaaccctttgaaaccactcccttcatgattatagtcttgtgagtcccagaaatcatttcctcgtaatcggtgtccccggtttctccaaggatgacata |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39814012 |
ctgaaccctttgaaaccactcccttcatgattatagtcttgtgagtcccagaaatcatttcctcgtaatcggtgtccccggtttctccaaggatgacata |
39813913 |
T |
|
| Q |
204 |
catgtttgcaacatttaatctccaacg |
230 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
39813912 |
catgtttgcaacatttaatctccaacg |
39813886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 15803011 - 15802816
Alignment:
| Q |
17 |
ttgtttcactaatgcatgcaacaagaggactctcatttggtacaacatcatctctttggtagcttcctggacctctaagcaattcttctgaaccctttga |
116 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| || |||||||||||||| |||||||| ||||||||||||||| | |||||||||||| || | |
|
|
| T |
15803011 |
ttgtttcagtaatacatgcaacaagaggactcttatcaggtacaacatcatccctttggtaacttcctggacctctatgtttttcttctgaacctttagc |
15802912 |
T |
|
| Q |
117 |
aaccactcccttcatgattatagtcttgtgagtcccagaaatcatttcctcgtaatcggtgtccccggtttctccaaggatgacatacatgtttgc |
212 |
Q |
| |
|
|| || || ||||||||||| |||||||| || |||||||||| |||||| ||||| ||||| || |||| |||||| || |||||||||||||| |
|
|
| T |
15802911 |
cacaacacctttcatgattattgtcttgtgtgttccagaaatcaattcctcataatcagtgtcaccagtttgtccaagaatcacatacatgtttgc |
15802816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University